p2R3a-TagRFP-OcsT
(Plasmid
#71270)
-
PurposeEntry clone containing TagRFP. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep2RP3-pGEMteasy
-
Backbone manufacturerampicillin resistant variant of pDONR-P2R-P3. attP2R-ccdB-cmR-attP3 sequences of pDONR-P2R-P3 were cloned into pGEMt-easy
-
Vector typeGateway
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagRFP
-
Tags
/ Fusion Proteins
- 4xGly linker (N terminal on insert)
- octaline synthase terminator (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13pUC-Fwd
- 3′ sequencing primer OCSterm-R (GGCGGTAAGGATCTGAGCTA) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2R3a-TagRFP-OcsT was a gift from Ari Pekka Mähönen (Addgene plasmid # 71270 ; http://n2t.net/addgene:71270 ; RRID:Addgene_71270) -
For your References section:
MultiSite Gateway compatible cell type-specific gene inducible system for plants. Siligato R, Wang X, Yadav SR, Lehesranta S, Ma G, Ursache R, Sevilem I, Zhang J, Gorte M, Prasad K, Wrzaczek M, Heidstra R, Murphy A, Scheres B, Mahonen AP. Plant Physiol. 2015 Dec 7. pii: pp.01246.2015. 10.1104/pp.15.01246 PubMed 26644504