Skip to main content

pGC629
(Plasmid #71364)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71364 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNL205
  • Backbone manufacturer
    Libina, et al. 2003. PMID 14622602
  • Total vector size (bp) 13565
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    daf-16
  • Species
    C. elegans (nematode)
  • Entrez Gene
    daf-16 (a.k.a. CELE_R13H8.1)
  • Promoter fos1a promoter
  • Tag / Fusion Protein
    • GFP(65C) (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GFP-F (GGTCCTTCTTGAGTTTGTAAC)
  • 3′ sequencing primer T7
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    fos1a promoter was PCR amplified from pBSfos-1p (a kind gift from David Sherwood).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGC629 was a gift from Jane Hubbard (Addgene plasmid # 71364 ; http://n2t.net/addgene:71364 ; RRID:Addgene_71364)
  • For your References section:

    Non-autonomous DAF-16/FOXO activity antagonizes age-related loss of C. elegans germline stem/progenitor cells. Qin Z, Hubbard EJ. Nat Commun. 2015 May 11;6:7107. doi: 10.1038/ncomms8107. 10.1038/ncomms8107 PubMed 25960195