pGC629
(Plasmid
#71364)
-
Purposeproximal somatic gonad expression of DAF-16 in C.elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNL205
-
Backbone manufacturerLibina, et al. 2003. PMID 14622602
- Total vector size (bp) 13565
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedaf-16
-
SpeciesC. elegans (nematode)
-
Entrez Genedaf-16 (a.k.a. CELE_R13H8.1)
- Promoter fos1a promoter
-
Tag
/ Fusion Protein
- GFP(65C) (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GFP-F (GGTCCTTCTTGAGTTTGTAAC)
- 3′ sequencing primer T7 (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byfos1a promoter was PCR amplified from pBSfos-1p (a kind gift from David Sherwood).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGC629 was a gift from Jane Hubbard (Addgene plasmid # 71364 ; http://n2t.net/addgene:71364 ; RRID:Addgene_71364) -
For your References section:
Non-autonomous DAF-16/FOXO activity antagonizes age-related loss of C. elegans germline stem/progenitor cells. Qin Z, Hubbard EJ. Nat Commun. 2015 May 11;6:7107. doi: 10.1038/ncomms8107. 10.1038/ncomms8107 PubMed 25960195