Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #71394)


Item Catalog # Description Quantity Price (USD)
Plasmid 71394 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5828
  • Total vector size (bp) 9031
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Grow at 30 degrees and no more than 16 hours to maintain lentiviral LTR repeats
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    mouse RNA polymerase II promoter- firefly luciferase-eGFP fusion gene
  • Species
    M. musculus (mouse); firefly and jellyfish
  • Insert Size (bp)
  • Promoter Pol2 (mouse RNA polymerase II gene promtoer)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATCCATTCGATTAGTGAACGG
  • 3′ sequencing primer GCCATACGGGAAGCAATAGC
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    eGFP gene was synthetically produced. FerH promoter was amplified from a plasmid from Invivogen
  • Articles Citing this Plasmid

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUGW-Pol2-ffLuc2-eGFP was a gift from Glenn Merlino (Addgene plasmid # 71394 ; ; RRID:Addgene_71394)
  • For your References section:

    Lentivirus-mediated bifunctional cell labeling for in vivo melanoma study. Day CP, Carter J, Bonomi C, Esposito D, Crise B, Ortiz-Conde B, Hollingshead M, Merlino G. Pigment Cell Melanoma Res. 2009 Jun;22(3):283-95. doi: 10.1111/j.1755-148X.2009.00545.x. Epub 2009 Jan 19. 10.1111/j.1755-148X.2009.00545.x PubMed 19175523