-
PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS316
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMixed Feedback Loop version of the UBER system
-
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and TetR RBS: GCACCAGCACGCACCGAATTCTAAGGGCGGTCAAAA
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer yCyc1proF1
- 3′ sequencing primer rrnB-T1-term-Rev (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please review publication for additional construct information
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MK1283 was a gift from Howard Salis (Addgene plasmid # 71428 ; http://n2t.net/addgene:71428 ; RRID:Addgene_71428) -
For your References section:
A portable expression resource for engineering cross-species genetic circuits and pathways. Kushwaha M, Salis HM. Nat Commun. 2015 Jul 17;6:7832. doi: 10.1038/ncomms8832. 10.1038/ncomms8832 PubMed 26184393