-
PurposeRetroviral construct to express FLAG-tagged MLL-AF9 fusion gene, followed by IRES-GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMIGL
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 11100
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMLL-Af9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4500
-
Entrez GeneKMT2A (a.k.a. ALL-1, ALL1, CXXC7, GAS7, HRX, HTRX, HTRX1, MLL, MLL1, MLL1A, TRX1, WDSTS)
- Promoter MSCV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer cccttgaacctcctcgttcgacc
- 3′ sequencing primer CCAAAAGACGGCAATATGGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJay Hess (University of Michigan)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIG-FLAG-MLL-AF9 was a gift from Daisuke Nakada (Addgene plasmid # 71443 ; http://n2t.net/addgene:71443 ; RRID:Addgene_71443) -
For your References section:
AMPK Protects Leukemia-Initiating Cells in Myeloid Leukemias from Metabolic Stress in the Bone Marrow. Saito Y, Chapple RH, Lin A, Kitano A, Nakada D. Cell Stem Cell. 2015 Sep 29. pii: S1934-5909(15)00374-4. doi: 10.1016/j.stem.2015.08.019. 10.1016/j.stem.2015.08.019 PubMed 26440282