-
Purpose3rd generation lentiviral expression of STAT2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71451 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV-tetO-CMV-SV40-puro-LoxP
-
Backbone manufacturerAndrei Gudkov lab
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSTAT2
-
SpeciesH. sapiens (human)
-
Entrez GeneSTAT2 (a.k.a. IMD44, ISGF-3, P113, PTORCH3, STAT113)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GGAGTTTGTTTTGGCACCA
- 3′ sequencing primer CTCTTTCAGAGGTTATTTCAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-STAT2 was a gift from George Stark (Addgene plasmid # 71451 ; http://n2t.net/addgene:71451 ; RRID:Addgene_71451) -
For your References section:
IFNbeta-dependent increases in STAT1, STAT2, and IRF9 mediate resistance to viruses and DNA damage. Cheon H, Holvey-Bates EG, Schoggins JW, Forster S, Hertzog P, Imanaka N, Rice CM, Jackson MW, Junk DJ, Stark GR. EMBO J. 2013 Oct 16;32(20):2751-63. doi: 10.1038/emboj.2013.203. Epub 2013 Sep 24. 10.1038/emboj.2013.203 PubMed 24065129