pG1AK-mCherry
(Plasmid
#71737)
-
PurposeModular shuttle vector for Geobacillus and E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepG1AK
- Backbone size w/o insert (bp) 4719
- Total vector size (bp) 5620
-
Vector typeBacterial Expression, Synthetic Biology ; Shuttle Vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)687
- Promoter pRplsWT
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer -
- 3′ sequencing primer AGCGGATAACAATTTCACACAGGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe Leak lab, (Department of Biology & Biochemistry, University of Bath). Part of these plasmids are from pUCG18.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pG1AK-mCherry was a gift from Tom Ellis (Addgene plasmid # 71737 ; http://n2t.net/addgene:71737 ; RRID:Addgene_71737) -
For your References section:
The Geobacillus Plasmid Set: A Modular Toolkit for Thermophile Engineering. Reeve B, Martinez-Klimova E, de Jonghe J, Leak DJ, Ellis T. ACS Synth Biol. 2016 Jul 1. 10.1021/acssynbio.5b00298 PubMed 27332993