-
PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and non-targeting control sgRNA for use in human cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Zagreb, Faculty of Science
Located in Croatia -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 71830-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 71830-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepdCas9-DNMT3A-PuroR
- Backbone size w/o insert (bp) 10134
- Total vector size (bp) 10154
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNon-targeting sgRNA human
-
Alt namedCas9-DNMT3A-PuroR_hNT
-
Alt nameSpdCas9-DNMT3A-T2A-PuroR_hNT
-
Alt namedCas9-DNMT3A_hNT
-
gRNA/shRNA sequenceNon-targeting
-
SpeciesH. sapiens (human), Synthetic; S. pyogenes
-
Insert Size (bp)5906
-
MutationD10A and H840A in S.pyogenes Cas9
-
GenBank IDAKA60242.1 NP_072046.2
-
Entrez GeneDNMT3A (a.k.a. DNMT3A-3, DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
- Promoter U6
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- SV40 NLS (N terminal on insert)
- T2A-PuroR (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe plasmid is derived from Addgene plasmids #35521 and #48141.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The catalytic domain of human DNMT3A (amino acids P602-V912) was derived from the plasmid pcDNA3/Myc-DNMT3A (Addgene, plasmid #35521) (Chen et al., 2005, J Cell Biochem 95: 902-917). Undesired BbsI restriction site was removed by site-directed mutagenesis, without affecting the amino acid sequence.
Plasmid pSpCas9n(BB)-2A-Puro (PX462) (Addgene, plasmid #48141) (Ran et al., 2013, Nat Protoc 8: 2281-2308) was used as a backbone. Additional H840A mutation was introduced into Cas9n D10A nickase.
Human non-targeting sgRNA is cloned between BbsI restriction sites.
DNA (Catalog # 71830-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 71830-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdCas9-DNMT3A-PuroR_hNT was a gift from Vlatka Zoldos (Addgene plasmid # 71830 ; http://n2t.net/addgene:71830 ; RRID:Addgene_71830) -
For your References section:
Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Vojta A, Dobrinic P, Tadic V, Bockor L, Korac P, Julg B, Klasic M, Zoldos V. Nucleic Acids Res. 2016 Mar 11. pii: gkw159. 10.1093/nar/gkw159 PubMed 26969735