Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Sema6c-AP-His
(Plasmid #72041)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72041 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sema6c
  • Alt name
    Semaphorin 6C; Semay
  • Alt name
    NCBI gene ID 20360; Reference sequence NM_011351.2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1809
  • Entrez Gene
    Sema6c (a.k.a. Semay, mKIAA1869)
  • Promoter CMV
  • Tag / Fusion Protein
    • AP-His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GTCAGAGGTAACTCCCGTTGC
  • 3′ sequencing primer GAGGTTCTTGGCGGCTGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sema6c-AP-His was a gift from Woj Wojtowicz (Addgene plasmid # 72041 ; http://n2t.net/addgene:72041 ; RRID:Addgene_72041)
  • For your References section:

    An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812