Skip to main content

Nrp2.1-Fc-His
(Plasmid #72098)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72098 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMVi-SV40ori
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nrp2.1
  • Alt name
    Neuropilin 2, isoform 1; Np2; Np-2; Npn2; Npn-2
  • Alt name
    NCBI gene ID 18187; Reference sequence NM_001077403.1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2601
  • Entrez Gene
    Nrp2 (a.k.a. 1110048P06Rik, N, Np, Np-2, Np2, Npn-2, Npn2)
  • Promoter CMV
  • Tag / Fusion Protein
    • Fc-His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GTCAGAGGTAACTCCCGTTGC
  • 3′ sequencing primer ATCATGAGGGTGTCCTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Nrp2.1-Fc-His was a gift from Woj Wojtowicz (Addgene plasmid # 72098 ; http://n2t.net/addgene:72098 ; RRID:Addgene_72098)
  • For your References section:

    An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812