Sema3b(S)-Fc-His
              
              
                (Plasmid
                
                #72140)
              
            
            
            
          - 
            PurposeExpresses the Sema3B protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCMVi-SV40ori
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameSema3b
- 
                  Alt nameSemaphorin 3B
- 
                  Alt nameNCBI gene ID 20347; Reference sequence NM_001042779.2
- 
                    SpeciesM. musculus (mouse)
- 
                  Insert Size (bp)1644
- 
                        Entrez GeneSema3b (a.k.a. LUCA, Se, SemA, Semaa, sem, sema5, semaV)
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - Fc-His (C terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer GTCAGAGGTAACTCCCGTTGC
- 3′ sequencing primer ATCATGAGGGTGTCCTTG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene Sanger sequencing found V117M, T122A, T190A, and I502V within the Sema3b translation compared to NM_001042779.2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: Sema3b(S)-Fc-His was a gift from Woj Wojtowicz (Addgene plasmid # 72140 ; http://n2t.net/addgene:72140 ; RRID:Addgene_72140)
- 
                For your References section: An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812
 
    
 
                         
             
            