Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #72179)


Item Catalog # Description Quantity Price (USD)
Plasmid 72179 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Unc5B, isoform z; Unc5h2
  • Alt name
    NCBI gene ID 107449
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Unc5b (a.k.a. 6330415E02Rik, A630020F16, D10Bwg0792e, Unc5h2)
  • Promoter CMV
  • Tag / Fusion Protein
    • Fc-His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GTCAGAGGTAACTCCCGTTGC
  • 3′ sequencing primer ATCATGAGGGTGTCCTTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Unc5b.z is missing exon 8.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Unc5b.z-Fc-His was a gift from Woj Wojtowicz (Addgene plasmid # 72179 ; ; RRID:Addgene_72179)
  • For your References section:

    An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812