-
PurposeExpress copGFP under EF-1 promoter when Cre is expressed by another vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCDH-CMV-MCS
-
Backbone manufacturerSystembio
- Total vector size (bp) 8164
-
Modifications to backboneClaI to KpnI was removed and replaced with EF1 promoter and WPRE
-
Vector typeLentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecopGFP
-
SpeciesSynthetic
-
Insert Size (bp)755
- Promoter elongation factor-1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GCA CTT GAT GTA ATT CTC C
- 3′ sequencing primer CAACACCACGGAATTGTCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-EF1-DIO-copGFP was a gift from Kazuhiro Oka (Addgene plasmid # 72253 ; http://n2t.net/addgene:72253 ; RRID:Addgene_72253)