Skip to main content

pCDH-CB-IRES-copGFP-T2A-Puro
(Plasmid #72299)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72299 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCDH-CMV-MCS
  • Backbone manufacturer
    Systembio
  • Backbone size (bp) 6677
  • Modifications to backbone
    ClaI/SalI fragment was replaced with CB promoter + MCS
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter chicken beta-actin + CMV enhancer
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGGTGGTGGTGCAAATCAAA
  • 3′ sequencing primer CAACACCACGGAATTGTCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositor noted that the single nucleotide mismatch (G>A, bp 3249) within IRES found in Addgene's quality control sequence does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-CB-IRES-copGFP-T2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 72299 ; http://n2t.net/addgene:72299 ; RRID:Addgene_72299)