-
Purpose(Empty Backbone) Mammalian expression of secreted mMBP-fused proteins with C-terminal 6His-tag/Strep-tag II/HA-tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHLmMBP-1
- Backbone size (bp) 5856
-
Vector typeMammalian Expression
- Promoter CMV enhancer + chicken beta-actin promoter
-
Tags
/ Fusion Proteins
- mMBP (N terminal on backbone)
- 6His-tag (C terminal on backbone)
- Strep-tag II (C terminal on backbone)
- HA-tag (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer AAGGTGAAATCATGCCCAACATCC
- 3′ sequencing primer ATTTGTGAGCCAGGGCATTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byProf. Dr. A. Radu Aricescu (pHLsec)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning note: For cloning information, please refer to Figure S1 of the manuscript associated with this plasmid.
Mutagenesis note: Quikchange mutagenesis does not work efficiently on this family of plasmids.
Citation for pHLsec from which this plasmid is derived:
A time- and cost-efficient system for high-level protein production in mammalian cells
A. R. Aricescu, W. Lu and E. Y. Jones
Acta Cryst. D62:1243-1250 (2006)
PMID:17001101
doi:10.1107/S0907444906029799
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHLmMBP-1 was a gift from Luca Jovine (Addgene plasmid # 72343 ; http://n2t.net/addgene:72343 ; RRID:Addgene_72343) -
For your References section:
Easy mammalian expression and crystallography of maltose-binding protein-fused human proteins. Bokhove M, Sadat Al Hosseini H, Saito T, Dioguardi E, Gegenschatz-Schmid K, Nishimura K, Raj I, de Sanctis D, Han L, Jovine L. J Struct Biol. 2016 Feb 3. 194:1-7. pii: S1047-8477(16)30015-6. doi: 10.1016/j.jsb.2016.01.016. 10.1016/j.jsb.2016.01.016 PubMed 26850170