PX458_HHEX_2
(Plasmid
#72355)
-
PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFP
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX458
- Backbone size w/o insert (bp) 9289
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHHEX
-
gRNA/shRNA sequenceGTCTGAACATGCCAATGCCAG
-
SpeciesH. sapiens (human)
-
Entrez GeneHHEX (a.k.a. HEX, HMPH, HOX11L-PEN, PRH, PRHX)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pBR322ori-F
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458_HHEX_2 was a gift from Eric Mendenhall & Richard M. Myers (Addgene plasmid # 72355 ; http://n2t.net/addgene:72355 ; RRID:Addgene_72355)