shGFP neo
(Plasmid
#72571)
-
PurposeHairpin targeting GFP.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 neo
-
Backbone manufacturerSheila Stewart
- Backbone size w/o insert (bp) 7200
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
gRNA/shRNA sequenceGCAAGCTGACCCTGAAGTTCAT
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer NA
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shGFP neo was a gift from Kevin Janes (Addgene plasmid # 72571 ; http://n2t.net/addgene:72571 ; RRID:Addgene_72571) -
For your References section:
Network Architecture Predisposes an Enzyme to Either Pharmacologic or Genetic Targeting. Jensen KJ, Moyer CB, Janes KA. Cell Syst. 2016 Feb 24;2(2):112-121. 10.1016/j.cels.2016.01.012 PubMed 26942229