Skip to main content

pDECKO_TFRC_C (with mCherry)
(Plasmid #72627)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72627 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDECKO-mCherry
  • Backbone size w/o insert (bp) 9400
  • Modifications to backbone
    Inserted T2A-mCherry downstream of EF1alpha-PuroR cassette
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNAs toward TFRC
  • gRNA/shRNA sequence
    gRNA1:GGGGAGCGGGAAAGCGGTCG; gRNA2:AACTGACCTTCAGGCCCGTA
  • Species
    H. sapiens (human)
  • Promoter U6 (gRNA1) and H1 (gRNA2)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • 3′ sequencing primer hGata4-rev (5'-ATTGTGGATGAATACTGCC-3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDECKO_TFRC_C (with mCherry) was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 72627 ; http://n2t.net/addgene:72627 ; RRID:Addgene_72627)
  • For your References section:

    DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigo R, Johnson R. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. 10.1186/s12864-015-2086-z [pii] PubMed 26493208