pLL3.7 shRNA against CRTC2
(Plasmid
#72711)
-
PurposeLentiviral expression of shRNA against CRTC2 (3rd generation)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.7
-
Backbone manufacturerLuk Parijs, Addgene Plasmid #11795
- Backbone size w/o insert (bp) 7649
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCRTC2
-
gRNA/shRNA sequence5-TCTCTGCCCAATGTTAACCA-3
-
SpeciesM. musculus (mouse), R. norvegicus (rat)
- Promoter U6
-
Tag
/ Fusion Protein
- CMV-EGFP (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer mU6-F (ATATCCCTTGGAGAAAAGCCTT)
- 3′ sequencing primer EGFP-N (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL3.7 shRNA against CRTC2 was a gift from Freddy Jeanneteau (Addgene plasmid # 72711 ; http://n2t.net/addgene:72711 ; RRID:Addgene_72711) -
For your References section:
BDNF and glucocorticoids regulate corticotrophin-releasing hormone (CRH) homeostasis in the hypothalamus. Jeanneteau FD, Lambert WM, Ismaili N, Bath KG, Lee FS, Garabedian MJ, Chao MV. Proc Natl Acad Sci U S A. 2012 Jan 24;109(4):1305-10. doi: 10.1073/pnas.1114122109. Epub 2012 Jan 9. 10.1073/pnas.1114122109 PubMed 22232675