Skip to main content

pLL3.7 shRNA against CRTC2
(Plasmid #72711)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72711 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL3.7
  • Backbone manufacturer
    Luk Parijs, Addgene Plasmid #11795
  • Backbone size w/o insert (bp) 7649
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CRTC2
  • gRNA/shRNA sequence
    5-TCTCTGCCCAATGTTAACCA-3
  • Species
    M. musculus (mouse), R. norvegicus (rat)
  • Promoter U6
  • Tag / Fusion Protein
    • CMV-EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer mU6-F (ATATCCCTTGGAGAAAAGCCTT)
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL3.7 shRNA against CRTC2 was a gift from Freddy Jeanneteau (Addgene plasmid # 72711 ; http://n2t.net/addgene:72711 ; RRID:Addgene_72711)
  • For your References section:

    BDNF and glucocorticoids regulate corticotrophin-releasing hormone (CRH) homeostasis in the hypothalamus. Jeanneteau FD, Lambert WM, Ismaili N, Bath KG, Lee FS, Garabedian MJ, Chao MV. Proc Natl Acad Sci U S A. 2012 Jan 24;109(4):1305-10. doi: 10.1073/pnas.1114122109. Epub 2012 Jan 9. 10.1073/pnas.1114122109 PubMed 22232675