shGLDC-DOX
(Plasmid
#72883)
-
Purposedox inducible knockdown
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO-GC11
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRNAi hairpin against GLDC
-
gRNA/shRNA sequenceGAAGTTTATGAGTCTCCATTT
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (destroyed during cloning)
- 3′ cloning site EcoR1 (unknown if destroyed)
- 5′ sequencing primer pLKO-r
- 3′ sequencing primer TAG TTT GTA TGT CTG TTG CTA TTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shGLDC-DOX was a gift from David Sabatini (Addgene plasmid # 72883 ; http://n2t.net/addgene:72883 ; RRID:Addgene_72883) -
For your References section:
SHMT2 drives glioma cell survival in ischaemia but imposes a dependence on glycine clearance. Kim D, Fiske BP, Birsoy K, Freinkman E, Kami K, Possemato RL, Chudnovsky Y, Pacold ME, Chen WW, Cantor JR, Shelton LM, Gui DY, Kwon M, Ramkissoon SH, Ligon KL, Kang SW, Snuderl M, Vander Heiden MG, Sabatini DM. Nature. 2015 Apr 16;520(7547):363-7. doi: 10.1038/nature14363. Epub 2015 Apr 8. 10.1038/nature14363 PubMed 25855294