Skip to main content

N1-mSin1.1-GFP
(Plasmid #72907)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72907 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6290
  • Modifications to backbone
    Kozak and start ATG before eGFP were mutated: caccatgg to aaccttgg Linker was added before Kozak (aaccttgg): cgggcccgggatccaccggtcgc
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mSin1.1
  • Alt name
    MAPKAP1
  • Alt name
    stress-activated map kinase interacting protein 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1566
  • Entrez Gene
    MAPKAP1 (a.k.a. JC310, MIP1, SIN1, SIN1b, SIN1g)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer taacaactccgccccatt
  • 3′ sequencing primer tccagctcgaccaggatgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

mSin1.1 was amplified from HEK293 cDNA library

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N1-mSin1.1-GFP was a gift from Ivan Yudushkin (Addgene plasmid # 72907 ; http://n2t.net/addgene:72907 ; RRID:Addgene_72907)
  • For your References section:

    Localization of mTORC2 activity inside cells. Ebner M, Sinkovics B, Szczygiel M, Ribeiro DW, Yudushkin I. J Cell Biol. 2017 Jan 31. pii: jcb.201610060. doi: 10.1083/jcb.201610060. 10.1083/jcb.201610060 PubMed 28143890