Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #72992)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 72992 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3039
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    L1 RBS
  • Species
  • Mutation
    CAT gene - C435G (nucleotide) - silent mutagenesis to remove BsmBI site

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer VF2 (5' tgccacctgacgtctaagaa 3')
  • 3′ sequencing primer VR (5' attaccgcctttgagtgagc 3')
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBP-TL8 was a gift from Paul Freemont (Addgene plasmid # 72992 ; ; RRID:Addgene_72992)
  • For your References section:

    EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology. Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. ACS Synth Biol. 2016 May 2. 10.1021/acssynbio.6b00031 PubMed 27096716