-
PurposeExpresses BE3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73021 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCMV
-
Backbone manufacturerorigene
- Backbone size w/o insert (bp) 3399
- Total vector size (bp) 8532
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBE3
-
Alt namerAPOBEC1-XTEN-Cas9n-UGI-NLS
-
SpeciesR. norvegicus (rat); S. pyogenes
-
Insert Size (bp)5133
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV
- 3′ sequencing primer TGGTTCTTTCCGCCTCAGAAGC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-BE3 was a gift from David Liu (Addgene plasmid # 73021 ; http://n2t.net/addgene:73021 ; RRID:Addgene_73021) -
For your References section:
Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Nature. 2016 Apr 20. doi: 10.1038/nature17946. 10.1038/nature17946 PubMed 27096365