Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET28-Mff(1-61)-PP-GST
(Plasmid #73042)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73042 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28a(+)
  • Backbone manufacturer
    EMD Millipore (Novagen)
  • Modifications to backbone
    A pET21b promoter (BglII/BamHI), followed by a PreScission protease site (BamHI/HindIII) and the GST sequence from pGEX6P1 (NotI/XhoI, Amersham) replaces the region between BglII/XhoI of pET28a(+)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Mff(1-61)
  • Alt name
    mitochondrial fission factor
  • Species
    M. musculus (mouse)
  • Mutation
    Truncation containing amino acids 1-61
  • Entrez Gene
    Mff (a.k.a. 5230400G24Rik, AI314724)
  • Promoter T7
  • Tags / Fusion Proteins
    • PreScission protease site (C terminal on backbone)
    • GST-tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28-Mff(1-61)-PP-GST was a gift from David Chan (Addgene plasmid # 73042 ; http://n2t.net/addgene:73042 ; RRID:Addgene_73042)
  • For your References section:

    The mitochondrial fission receptor Mff selectively recruits oligomerized Drp1. Liu R, Chan DC. Mol Biol Cell. 2015 Dec 1;26(24):4466-77. doi: 10.1091/mbc.E15-08-0591. Epub 2015 Oct 7. 10.1091/mbc.E15-08-0591 PubMed 26446846