-
Purposedetection of activity of ubiquitous calpains
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepeYFP
-
Backbone manufacturerClontech
- Total vector size (bp) 5456
-
Modifications to backbonePlasmids peYFP and peCFP were obtained from Clontech. pTOM plasmid, containing eYFP and eCFP, respectively, in 5′ and 3′ of the multi-cloning site was obtained after digestion of peYFP and peCFP by XhoI and HpaI and religation of the eCFP fragment in peYFP. pCalpain-sensor was obtained by digestion of pTOM with BspeI and BamHI and ligation of the following primers: 5′-PCCGGAAGCGGCCAGCAGGAGGTGTATGGTGCGATGCCCAGGGATGGCTCAGGG-3′ and 5′-P-GATCCCCTGAGCCATCCCAGGGCATAGCACCATACACCTCCTGCTGGCCGCTT-3′, which encode the linkers and the mouse α-fodrin cleavage site by ubiquitous calpains. The peptide sequence of the linker and the α-fodrin cleavage site is GSG-QQEVY GAMPRDGSG. GSG corresponds to linker sequences
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namealpha-Fodrin cleavage site
-
Alt namecalpain sensor
-
Alt nameEYFP--calpain clevage site from alpha-Fodrin--ECFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)53
-
Entrez GeneSptan1 (a.k.a. 2610027H02Rik, Spna-2, Spna2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- eYFP (N terminal on insert)
- eCFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bspe1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-calpainsensor was a gift from Isabelle Richard (Addgene plasmid # 36182 ; http://n2t.net/addgene:36182 ; RRID:Addgene_36182) -
For your References section:
Imaging calpain protease activity by multiphoton FRET in living mice. Stockholm D, Bartoli M, Sillon G, Bourg N, Davoust J, Richard I. J Mol Biol. 2005 Feb 11;346(1):215-22. Epub 2004 Dec 16. 10.1016/j.jmb.2004.11.039 PubMed 15663939