Skip to main content

pLAREG
(Plasmid #73044)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73044 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS4D1
  • Backbone manufacturer
    Murphy, et al. PMID 17652177
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    EGFP
  • Species
    Aequorea victoria
  • Promoter hybrid dual-mode promoter-see comments

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer URA3-R2 (TTGGCGGATAATGCCTTTAG)
  • 3′ sequencing primer yGFP-R (GCATCACCTTCACCTTCACC)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    LacI
  • Species
    E.coli
  • Promoter GAL1 promoter

Cloning Information for Gene/Insert 2

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Five response element (RE) sequences with binding affinity for the androgen receptor (AR) protein are placed upstream of the TATA box of the minimal S. cerevisiae cytochrome C promoter (minCYC), and a LacI binding sequence (Olac) is placed downstream of the TATA box. Androgen receptor binding to the response elements serves to activate the promoter, while LacI binding to its operator site serves to repress promoter activity as measured by yEGFP expression levels.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLAREG was a gift from David McMillen (Addgene plasmid # 73044 ; http://n2t.net/addgene:73044 ; RRID:Addgene_73044)
  • For your References section:

    Design and characterization of a dual-mode promoter with activation and repression capability for tuning gene expression in yeast. Mazumder M, McMillen DR. Nucleic Acids Res. 2014 Aug;42(14):9514-22. doi: 10.1093/nar/gku651. Epub 2014 Jul 23. 10.1093/nar/gku651 PubMed 25056312