pLAREG
(Plasmid
#73044)
-
PurposeInducible expression of EGFP in yeast. Has dual-mode promoter with activation and repression capability for tuning gene expression in yeast.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS4D1
-
Backbone manufacturerMurphy, et al. PMID 17652177
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEGFP
-
SpeciesAequorea victoria
- Promoter hybrid dual-mode promoter-see comments
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer URA3-R2 (TTGGCGGATAATGCCTTTAG)
- 3′ sequencing primer yGFP-R (GCATCACCTTCACCTTCACC) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameLacI
-
SpeciesE.coli
- Promoter GAL1 promoter
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer Gal1ProF2 (CGAAGCGATGATTTTTGATC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Five response element (RE) sequences with binding affinity for the androgen receptor (AR) protein are placed upstream of the TATA box of the minimal S. cerevisiae cytochrome C promoter (minCYC), and a LacI binding sequence (Olac) is placed downstream of the TATA box. Androgen receptor binding to the response elements serves to activate the promoter, while LacI binding to its operator site serves to repress promoter activity as measured by yEGFP expression levels.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLAREG was a gift from David McMillen (Addgene plasmid # 73044 ; http://n2t.net/addgene:73044 ; RRID:Addgene_73044) -
For your References section:
Design and characterization of a dual-mode promoter with activation and repression capability for tuning gene expression in yeast. Mazumder M, McMillen DR. Nucleic Acids Res. 2014 Aug;42(14):9514-22. doi: 10.1093/nar/gku651. Epub 2014 Jul 23. 10.1093/nar/gku651 PubMed 25056312