pLAREG
(Plasmid #73044)

• Purpose: Inducible expression of EGFP in yeast. Has dual-mode promoter with activation and repression capability for tuning gene expression in yeast.
• Depositing Lab: David McMillen
• Publication: Mazumder et al Nucleic Acids Res. 2014 Aug;42(14):9514-22. doi: 10.1093/nar/gku651. Epub 2014 Jul 23.

Backbone

• Vector backbone: pRS4D1
• Backbone manufacturer: Murphy, et al. PMID 17652177
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: EGFP
• Species: Aequorea victoria
• Promoter: hybrid dual-mode promoter-see comments

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: URA3-R2 (TTGGCGGATAATGCCTTTAG)
• 3′ sequencing primer: yGFP-R (GCATCACCTTCACCTTCACC)

Gene/Insert 2

• Gene/Insert name: LacI
• Species: E.coli
• Promoter: GAL1 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: Gal1ProF2 (CGAAGCGATGATTTTTGATC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Five response element (RE) sequences with binding affinity for the androgen receptor (AR) protein are placed upstream of the TATA box of the minimal S. cerevisiae cytochrome C promoter (minCYC), and a LacI binding sequence (Olac) is placed downstream of the TATA box. Androgen receptor binding to the response elements serves to activate the promoter, while LacI binding to its operator site serves to repress promoter activity as measured by yEGFP expression levels.