Skip to main content

pZW1-snoVector
(Plasmid #73174)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73174 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZW1
  • Backbone manufacturer
    Zefeng Wang's lab
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SNORD116-13
  • Alt name
    HBII-85-13
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    94
  • GenBank ID
    100033425
  • Entrez Gene
    SNORD116-13 (a.k.a. HBII-85-13)
  • Promoter CMV promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site SacII (destroyed during cloning)
  • 5′ sequencing primer EGFP-Seq-5F: GACCACATGAAGCAGCACGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SNORD116-14
  • Alt name
    HBII-85-14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    107
  • GenBank ID
    100033426
  • Entrez Gene
    SNORD116-14 (a.k.a. HBII-85-14)
  • Promoter CMV promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site SacII (destroyed during cloning)
  • 5′ sequencing primer EGFP-Seq-5F: GACCACATGAAGCAGCACGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Two snoRNA genes SNORD116-13 and SNORD116-14 from the Prader–Willi syndrome deletion region flanked by multiple cloning sites were inserted into the weak intron of Enhanced Green Fluoresence Protein (EGFP) such that only proper splicing leads to EGFP fluorescence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZW1-snoVector was a gift from Ling-Ling Chen (Addgene plasmid # 73174 ; http://n2t.net/addgene:73174 ; RRID:Addgene_73174)
  • For your References section:

    SnoVectors for nuclear expression of RNA. Yin QF, Hu SB, Xu YF, Yang L, Carmichael GG, Chen LL. Nucleic Acids Res. 2015 Jan;43(1):e5. doi: 10.1093/nar/gku1050. Epub 2014 Nov 5. 10.1093/nar/gku1050 PubMed 25378317