Skip to main content

pSLC-242
(Plasmid #73189)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73189 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSLC-217
  • Backbone manufacturer
    Swaine Chen Lab
  • Backbone size w/o insert (bp) 4549
  • Total vector size (bp) 4099
  • Modifications to backbone
    Changed kanamycin resistance gene to chloramphenicol
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Growth instructions
    Add 2% glucose
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    chloramphenicol
  • Species
    Although Ampicillin gene is present, it was inactivated while cloning.
  • Insert Size (bp)
    1159
  • Entrez Gene
    cat (a.k.a. pFL129_2)
  • Promoter chloramphenicol promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaL1 (unknown if destroyed)
  • 3′ cloning site SacII (unknown if destroyed)
  • 5′ sequencing primer AGTACTGTTGTATTCATTAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLC-242 was a gift from Swaine Chen (Addgene plasmid # 73189 ; http://n2t.net/addgene:73189 ; RRID:Addgene_73189)
  • For your References section:

    A set of powerful negative selection systems for unmodified Enterobacteriaceae. Khetrapal V, Mehershahi K, Rafee S, Chen S, Lim CL, Chen SL. Nucleic Acids Res. 2015 Jul 27;43(13):e83. doi: 10.1093/nar/gkv248. Epub 2015 Mar 23. 10.1093/nar/gkv248 PubMed 25800749