pSLC-242
(Plasmid #73189)

• Purpose: Template plasmid which encodes chloramphenicol resistance gene for positive selection and a toxin gene (relE) under the control of rhamnose induceable promoter (PrhaB) for negative selection.
• Depositing Lab: Swaine Chen
• Publication: Khetrapal et al Nucleic Acids Res. 2015 Jul 27;43(13):e83. doi: 10.1093/nar/gkv248. Epub 2015 Mar 23.

Backbone

• Vector backbone: pSLC-217
• Backbone manufacturer: Swaine Chen Lab
• Backbone size w/o insert (bp): 4549
• Total vector size (bp): 4099
• Modifications to backbone: Changed kanamycin resistance gene to chloramphenicol
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Growth instructions: Add 2% glucose
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: chloramphenicol
• Species: Although Ampicillin gene is present, it was inactivated while cloning.
• Insert Size (bp): 1159
• Entrez Gene: cat (a.k.a. pFL129_2)
• Promoter: chloramphenicol promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaL1 (unknown if destroyed)
• 3′ cloning site: SacII (unknown if destroyed)
• 5′ sequencing primer: AGTACTGTTGTATTCATTAA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry