pSLC-242
(Plasmid
#73189)
-
PurposeTemplate plasmid which encodes chloramphenicol resistance gene for positive selection and a toxin gene (relE) under the control of rhamnose induceable promoter (PrhaB) for negative selection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSLC-217
-
Backbone manufacturerSwaine Chen Lab
- Backbone size w/o insert (bp) 4549
- Total vector size (bp) 4099
-
Modifications to backboneChanged kanamycin resistance gene to chloramphenicol
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Growth instructionsAdd 2% glucose
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namechloramphenicol
-
SpeciesAlthough Ampicillin gene is present, it was inactivated while cloning.
-
Insert Size (bp)1159
-
Entrez Genecat (a.k.a. pFL129_2)
- Promoter chloramphenicol promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaL1 (unknown if destroyed)
- 3′ cloning site SacII (unknown if destroyed)
- 5′ sequencing primer AGTACTGTTGTATTCATTAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLC-242 was a gift from Swaine Chen (Addgene plasmid # 73189 ; http://n2t.net/addgene:73189 ; RRID:Addgene_73189) -
For your References section:
A set of powerful negative selection systems for unmodified Enterobacteriaceae. Khetrapal V, Mehershahi K, Rafee S, Chen S, Lim CL, Chen SL. Nucleic Acids Res. 2015 Jul 27;43(13):e83. doi: 10.1093/nar/gkv248. Epub 2015 Mar 23. 10.1093/nar/gkv248 PubMed 25800749