Skip to main content

pSLC-237
(Plasmid #73191)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73191 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKD4
  • Backbone manufacturer
    Barry L. Wanner
  • Backbone size w/o insert (bp) 3300
  • Total vector size (bp) 4779
  • Modifications to backbone
    First inserted SmaI, AatII, SacII sites and chloramphenicol resistance gene at Afe1 site in pKD4, followed by insertion of ParaB-relE at SmaI site using blunt cloning.
  • Vector type
    Bacterial Expression
  • Selectable markers
    Ampicillin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Growth instructions
    Add 2% glucose
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ParaB-relE
  • Insert Size (bp)
    1482
  • Promoter ParaB

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer CGGAATCGTTTTCCGGGACG
  • 3′ sequencing primer ATTAGCCATGGTCCATATGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLC-237 was a gift from Swaine Chen (Addgene plasmid # 73191 ; http://n2t.net/addgene:73191 ; RRID:Addgene_73191)
  • For your References section:

    A set of powerful negative selection systems for unmodified Enterobacteriaceae. Khetrapal V, Mehershahi K, Rafee S, Chen S, Lim CL, Chen SL. Nucleic Acids Res. 2015 Jul 27;43(13):e83. doi: 10.1093/nar/gkv248. Epub 2015 Mar 23. 10.1093/nar/gkv248 PubMed 25800749