pcDNA3.1-kappa-HA-dL5-BKa
(Plasmid #73212)

• Purpose: Expresses HA-dL5(E52D)-BKa (KCNMA1, mSlo alpha subunit) in mammalian cells, with an Igk-leader. (MBIC5, dL5**, FAP)
• Depositing Lab: Marcel Bruchez
• Publication: Pratt et al Bioconjug Chem. 2015 Sep 16;26(9):1963-71. doi: 10.1021/acs.bioconjchem.5b00409. Epub 2015 Sep 2.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 5626
• Total vector size (bp): 9889
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BKalpha
• Alt name: Slo1
• Alt name: MaxiK
• Alt name: BKalpha
• Species: M. musculus (mouse)
• Insert Size (bp): 4263
• Entrez Gene: Kcnma1 (a.k.a. 5730414M22Rik, BKCA alpha, BKCa, KCa1.1, MaxiK, Slo, Slo1, k(VCA)alpha, mSlo, mSlo1, slo-alpha)
• Promoter: CMV
• Tag / Fusion Protein:
  • dL5** (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: MfeI (destroyed during cloning)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: BKalpha gene was received from Sonal Shruti & Alison Barth; gene was originally synthesized. Carnegie Mellon University
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

MfeI site was destroyed in cloning, but 3' ClaI site is useable for further subcloning.