SPHK1
(Plasmid
#73260)
-
PurposeBacterial expression for structure determination; may not be full ORF
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFB-LIC-Bse
-
Backbone manufacturerSGC, Addgene Plasmid #26108
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSPHK1
-
Alt nameSPHK1B-c012
-
Alt namegi|41282002
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1229
-
Entrez GeneSPHK1 (a.k.a. SPHK)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- His-6-TEV (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer fBac-1 (tattcataccgtcccacca)
- 3′ sequencing primer fBac-2 (gggaggttttttaaagcaagtaaa)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use SF9 for protein expression. See also 4V24: http://www.thesgc.org/structures/4V24
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SPHK1 was a gift from Nicola Burgess-Brown (Addgene plasmid # 73260 ; http://n2t.net/addgene:73260 ; RRID:Addgene_73260)