PsbA2-HMGS-HMGR-ATOB-NPTI
(Plasmid
#73338)
-
PurposeConstruct expressing the upper MVA pathway in Synechocystis PCC 6803
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 73338-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 73338-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePUC57 Genescript
- Backbone size w/o insert (bp) 2657
- Total vector size (bp) 9332
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHMGS-HMGR-ATOB-NPTI
-
Alt nameUpper MVA pathway genes
-
SpeciesEnterococcus faecalis and Escherichia coli
-
Insert Size (bp)6675
-
GenBank IDHMGS (AAO81154.1), HMGR (AAO81155.1), ATOB (AKK18188.1),
- Promoter psbA2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site AscI (unknown if destroyed)
- 5′ sequencing primer ACGATTGCGGCTTTAGCGTTC
- 3′ sequencing primer GGCGATCGCCCGTTACAATT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are a few discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies are not within the insert region and do NOT affect plasmid function.
DNA (Catalog # 73338-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 73338-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PsbA2-HMGS-HMGR-ATOB-NPTI was a gift from Anastasios Melis (Addgene plasmid # 73338 ; http://n2t.net/addgene:73338 ; RRID:Addgene_73338)