mg319
(Plasmid
#73367)
-
Purposeunc-70 tension sensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEXPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameunc-70::TSMod
-
SpeciesC. elegans (nematode)
- Promoter unc-70p
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer atttttaatgctactcattaagaacttacttgac
- 3′ sequencing primer AAAGCTGGGTacagtaaccttttttattcgtgt (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mg319 was a gift from Miriam Goodman (Addgene plasmid # 73367 ; http://n2t.net/addgene:73367 ; RRID:Addgene_73367) -
For your References section:
Mechanical control of the sense of touch by beta-spectrin. Krieg M, Dunn AR, Goodman MB. Nat Cell Biol. 2014 Mar;16(3):224-33. doi: 10.1038/ncb2915. Epub 2014 Feb 23. 10.1038/ncb2915 PubMed 24561618