Skip to main content
Addgene

pdCas9-M-3F2
(Plasmid #73428)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73428 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pdCas9
  • Backbone manufacturer
    Luciano Marraffini (Addgene plasmid # 46569)
  • Backbone size w/o insert (bp) 9296
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Repressor C4 (orthogonal T7-lac repressor)
  • gRNA/shRNA sequence
    ATTAATACGACTCACTAACG
  • Species
    Synthetic
  • Promoter Constitutive wild-type S. pyogenes promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer dCas9-F3 (CACGCATTGATTTGAGTCAGC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also encodes dCas9 and tracrRNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pdCas9-M-3F2 was a gift from Mattheos Koffas (Addgene plasmid # 73428 ; http://n2t.net/addgene:73428 ; RRID:Addgene_73428)
  • For your References section:

    Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Cress BF, Jones JA, Kim DC, Leitz QD, Englaender JA, Collins SM, Linhardt RJ, Koffas MA. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. 10.1093/nar/gkw231 PubMed 27079979