Skip to main content

pGex-4T-2_GATE-16
(Plasmid #73518)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73518 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGex-4T-2
  • Backbone manufacturer
    GE Healthcare Life Sciences
  • Backbone size w/o insert (bp) 4970
  • Total vector size (bp) 5320
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GATE-16
  • Alt name
    GABARAPL2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    351
  • Entrez Gene
    GABARAPL2 (a.k.a. ATG8, ATG8C, GATE-16, GATE16, GEF-2, GEF2)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer CCAGCAAGTATATAGCATGG
  • 3′ sequencing primer GCTTACAGACAAGCTGTGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGex-4T-2_GATE-16 was a gift from Dieter Willbold (Addgene plasmid # 73518 ; http://n2t.net/addgene:73518 ; RRID:Addgene_73518)
  • For your References section:

    Interaction of Bcl-2 with the autophagy-related GABAA receptor-associated protein (GABARAP): biophysical characterization and functional implications. Ma P, Schwarten M, Schneider L, Boeske A, Henke N, Lisak D, Weber S, Mohrluder J, Stoldt M, Strodel B, Methner A, Hoffmann S, Weiergraber OH, Willbold D. J Biol Chem. 2013 Dec 27;288(52):37204-15. doi: 10.1074/jbc.M113.528067. Epub 2013 Nov 15. 10.1074/jbc.M113.528067 PubMed 24240096