Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73945)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 73945 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    GE Healthcare Life Sciences
  • Backbone size w/o insert (bp) 4970
  • Total vector size (bp) 5320
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer CCAGCAAGTATATAGCATGG
  • 3′ sequencing primer GCTTACAGACAAGCTGTGAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGex-4T-2_GEC1 was a gift from Dieter Willbold (Addgene plasmid # 73945 ; ; RRID:Addgene_73945)
  • For your References section:

    Interaction of Bcl-2 with the autophagy-related GABAA receptor-associated protein (GABARAP): biophysical characterization and functional implications. Ma P, Schwarten M, Schneider L, Boeske A, Henke N, Lisak D, Weber S, Mohrluder J, Stoldt M, Strodel B, Methner A, Hoffmann S, Weiergraber OH, Willbold D. J Biol Chem. 2013 Dec 27;288(52):37204-15. doi: 10.1074/jbc.M113.528067. Epub 2013 Nov 15. 10.1074/jbc.M113.528067 PubMed 24240096