Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCW57.1 _3xHA-Ago2_RNAmut
(Plasmid #73539)


Item Catalog # Description Quantity Price (USD)
Plasmid 73539 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    David Root (Addgene plasmid # 41393)
  • Backbone size w/o insert (bp) 9354
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.
  • Copy number


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Mutation
    Small RNA binding mutant PAZ domain Y311A and F312A
  • Entrez Gene
    Ago2 (a.k.a. 1110029L17Rik, 2310051F07Rik, AI225898, AL022874, AW546247, Eif2c, Eif2c2, Gerp95, Gm10365, mKIAA4215)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • 3xHA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer GAACGGACGTGAAGAATGTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Vector linearized using NheI/BamH1 sites. Insert cloned by recombination using In-Fusion cloning. Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1 _3xHA-Ago2_RNAmut was a gift from Constance Ciaudo (Addgene plasmid # 73539 ; ; RRID:Addgene_73539)
  • For your References section:

    Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Ngondo RP, Cirera-Salinas D, Yu J, Wischnewski H, Bodak M, Vandormael-Pournin S, Geiselmann A, Wettstein R, Luitz J, Cohen-Tannoudji M, Ciaudo C. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023. 10.1016/j.stemcr.2017.12.023 PubMed 29396181