Skip to main content

shCDK6(2)
(Plasmid #73553)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73553 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMLP
  • Total vector size (bp) 8000
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA against CDK6
  • gRNA/shRNA sequence
    ACCGAGTAGTGCATCGCGATCT
  • Species
    H. sapiens (human)
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer CTTCGCGCCACCTTCTACTCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shCDK6(2) was a gift from Gerardo Ferbeyre (Addgene plasmid # 73553 ; http://n2t.net/addgene:73553 ; RRID:Addgene_73553)
  • For your References section:

    A CDK4/6-Dependent Epigenetic Mechanism Protects Cancer Cells from PML-induced Senescence. Acevedo M, Vernier M, Mignacca L, Lessard F, Huot G, Moiseeva O, Bourdeau V, Ferbeyre G. Cancer Res. 2016 Jun 1;76(11):3252-64. doi: 10.1158/0008-5472.CAN-15-2347. Epub 2016 Mar 29. 10.1158/0008-5472.CAN-15-2347 PubMed 27206849