Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73557)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 73557 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5169
  • Total vector size (bp) 5952
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter SV40
  • Tag / Fusion Protein
    • 3X-FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctttatccagccctcac
  • 3′ sequencing primer ggaatgtgtgtcagttagggt
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CDK2-3XFlag-pBabe was a gift from Gerardo Ferbeyre (Addgene plasmid # 73557 ; ; RRID:Addgene_73557)
  • For your References section:

    A CDK4/6-Dependent Epigenetic Mechanism Protects Cancer Cells from PML-induced Senescence. Acevedo M, Vernier M, Mignacca L, Lessard F, Huot G, Moiseeva O, Bourdeau V, Ferbeyre G. Cancer Res. 2016 Jun 1;76(11):3252-64. doi: 10.1158/0008-5472.CAN-15-2347. Epub 2016 Mar 29. 10.1158/0008-5472.CAN-15-2347 PubMed 27206849