CDK2-3XFlag-pBabe
(Plasmid
#73557)
-
Purposevector encoding a fusion protein between CDK2 and 3 Flag tags
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73557 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBabe
- Backbone size w/o insert (bp) 5169
- Total vector size (bp) 5952
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDK2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)783
- Promoter SV40
-
Tag
/ Fusion Protein
- 3X-FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ctttatccagccctcac
- 3′ sequencing primer ggaatgtgtgtcagttagggt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CDK2-3XFlag-pBabe was a gift from Gerardo Ferbeyre (Addgene plasmid # 73557 ; http://n2t.net/addgene:73557 ; RRID:Addgene_73557) -
For your References section:
A CDK4/6-Dependent Epigenetic Mechanism Protects Cancer Cells from PML-induced Senescence. Acevedo M, Vernier M, Mignacca L, Lessard F, Huot G, Moiseeva O, Bourdeau V, Ferbeyre G. Cancer Res. 2016 Jun 1;76(11):3252-64. doi: 10.1158/0008-5472.CAN-15-2347. Epub 2016 Mar 29. 10.1158/0008-5472.CAN-15-2347 PubMed 27206849