Skip to main content

pccGFPG83I
(Plasmid #73650)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73650 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pccGFPKAN
  • Backbone size w/o insert (bp) 7375
  • Total vector size (bp) 7414
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    glycophorin A- G83I
  • Alt name
    GpA-G83I
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    39
  • Mutation
    glycine 83 to isoleucine

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer catgactttgtttggcgagagcaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Engelman Lab
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pccGFPG83I was a gift from Alessandro Senes (Addgene plasmid # 73650 ; http://n2t.net/addgene:73650 ; RRID:Addgene_73650)
  • For your References section:

    Screening for transmembrane association in divisome proteins using TOXGREEN, a high-throughput variant of the TOXCAT assay. Armstrong CR, Senes A. Biochim Biophys Acta. 2016 Jul 21. pii: S0005-2736(16)30251-6. doi: 10.1016/j.bbamem.2016.07.008. 10.1016/j.bbamem.2016.07.008 PubMed 27453198