pRS303 Bt δCOP
(Plasmid
#73871)
-
PurposeBos taurus Arcn1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS303
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRet2 Promoter- COPD
-
SpeciesB. taurus (bovine), S. cerevisiae (budding yeast)
- Promoter Ret2 Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer CAAGAACAAGGGCAATTAGCCTCAGCGTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS303 Bt δCOP was a gift from Blanche Schwappach (Addgene plasmid # 73871 ; http://n2t.net/addgene:73871 ; RRID:Addgene_73871) -
For your References section:
delta-COP contains a helix C-terminal to its longin domain key to COPI dynamics and function. Arakel EC, Richter KP, Clancy A, Schwappach B. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6916-21. doi: 10.1073/pnas.1603544113. Epub 2016 Jun 13. 10.1073/pnas.1603544113 PubMed 27298352