CAG-mCherry-RORbshRNA2
(Plasmid
#73984)
-
PurposeRORb shRNA2 (mir155 backbone) was inserted into the 3'UTR of mCherry.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73984 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG-mCherry
- Backbone size w/o insert (bp) 5568
- Total vector size (bp) 5632
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA that targets the mouse RORb gene
-
gRNA/shRNA sequencetctgacacagctccatgaag
-
SpeciesM. musculus (mouse)
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caccatcgtggaacagtacg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The shRNA cassette was obtained via the BLOCK-iTTM PolII miR RNAi Express (Life Technologies).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-mCherry-RORbshRNA2 was a gift from Connie Cepko (Addgene plasmid # 73984 ; http://n2t.net/addgene:73984 ; RRID:Addgene_73984) -
For your References section:
A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Wang S, Sengel C, Emerson MM, Cepko CL. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21. 10.1016/j.devcel.2014.07.018 PubMed 25155555