Skip to main content

CAG-EGFP-RORbshRNA1
(Plasmid #73985)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73985 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG-EGFP
  • Backbone size w/o insert (bp) 5622
  • Total vector size (bp) 5686
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA that targets the mouse RORb gene
  • gRNA/shRNA sequence
    caagttgggtacagatgtga
  • Species
    M. musculus (mouse)
  • Promoter CAG

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The shRNA cassette was obtained via the BLOCK-iTTM PolII miR RNAi Express (Life Technologies).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-EGFP-RORbshRNA1 was a gift from Connie Cepko (Addgene plasmid # 73985 ; http://n2t.net/addgene:73985 ; RRID:Addgene_73985)
  • For your References section:

    A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Wang S, Sengel C, Emerson MM, Cepko CL. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21. 10.1016/j.devcel.2014.07.018 PubMed 25155555