B108-Otx2-IRES-Cre
(Plasmid
#73993)
-
PurposeB108 enhancer of Blimp1 gene drives Otx2 (isoform b) and Cre expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73993 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonestagia3
-
Backbone manufacturerAddgene, Plasmid #28177
- Backbone size w/o insert (bp) 3298
- Total vector size (bp) 6043
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameB108-Otx2 (isoform b)-IRES-Cre
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2745
-
Entrez GeneOtx2 (a.k.a. E130306E05Rik)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAAATAGGCTGTCCCCAGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B108-Otx2-IRES-Cre was a gift from Connie Cepko (Addgene plasmid # 73993 ; http://n2t.net/addgene:73993 ; RRID:Addgene_73993) -
For your References section:
A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Wang S, Sengel C, Emerson MM, Cepko CL. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21. 10.1016/j.devcel.2014.07.018 PubMed 25155555