Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

FH95pUp95bGW (B5)
(Plasmid #74014)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74014 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    David Baltimore (Addgene plasmid # 14883)
  • Backbone size w/o insert (bp) 9941
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Psd95 shRNA
  • Alt name
    shRNA-resistant Psd95-EGFP fusion co-expressed
  • gRNA/shRNA sequence
    GGA CAT CCA GGC ACA CAA G
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Dlg4 (a.k.a. Dlgh4, PSD95, Sap90)
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BstBI (destroyed during cloning)
  • 5′ sequencing primer H1 tcgctatgtgttctgggaaa
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Map: FHUG+W-HinDIII-SalI-XbaI-(p95b)-KpnI-SacII-PspOMI-SmaI-BamHI-(GFP)-BglII-BsrBI-EcoRV-HinDIII-ClaI
Also associated with Liu, et al. J Neurophysiol. 2014 Feb;111(3):648-58. doi: 10.1152/jn.00262.2013 PMID 24225540.

Psd95 shRNA expressed under control of H1 promoter. Psd95 coding sequence modified to GGATATTCAAGCGCATAAG make it resistant to the shRNA. Psd95-EGFP fusion protein expressed under control of UbC promoter.

The publication by Schluter et al linked above describes the creation of the beta isoform of Psd95 in detail

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FH95pUp95bGW (B5) was a gift from Robert Malenka & Oliver Schluter & Weifeng Xu (Addgene plasmid # 74014 ; http://n2t.net/addgene:74014 ; RRID:Addgene_74014)
  • For your References section:

    Alternative N-terminal domains of PSD-95 and SAP97 govern activity-dependent regulation of synaptic AMPA receptor function. Schluter OM, Xu W, Malenka RC. Neuron. 2006 Jul 6;51(1):99-111. 10.1016/j.neuron.2006.05.016 PubMed 16815335