Skip to main content

pMSCV-FLAG-hHelios-IRES-GFP
(Plasmid #74047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74047 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV-IRES-GFP (pMIG)
  • Backbone size w/o insert (bp) 7200
  • Total vector size (bp) 8598
  • Modifications to backbone
    SV40-ori added
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human Helios (IKZF2)
  • Mutation
    encodes shorter version of human Helios
  • GenBank ID
    NM_001079526.1
  • Entrez Gene
    IKZF2 (a.k.a. ANF1A2, HELIOS, ZNF1A2, ZNFN1A2)
  • Promoter pMSCV-LTRs
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site XHO1 (not destroyed)
  • 5′ sequencing primer CGTTCGACCCCGCCTCGATCC
  • 3′ sequencing primer AGCTTGATATCGAATTCCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cloned from human cDNA (CD4+ lymphocytes)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-FLAG-hHelios-IRES-GFP was a gift from Ria Baumgrass (Addgene plasmid # 74047 ; http://n2t.net/addgene:74047 ; RRID:Addgene_74047)
  • For your References section:

    Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333