Skip to main content
Addgene

pMIG-hNFATc2/C - AVITEV
(Plasmid #74058)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74058 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV-IRES-GFP (pMIG)
  • Backbone size w/o insert (bp) 7200
  • Total vector size (bp) 9935
  • Modifications to backbone
    added SV40 ori
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human NFATc2, isoform C
  • Alt name
    NFAT1
  • Alt name
    nuclear factor of activated T-cells 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2700
  • Mutation
    silent mutation A1723C in the sequence of NM_173091.3 (A1503C position in ORF of the vector)
  • GenBank ID
    NM_173091.3 Gene-ID: 4773
  • Entrez Gene
    NFATC2 (a.k.a. JCOSL, NFAT1, NFATP)
  • Promoter pMSCV-LTRs
  • Tag / Fusion Protein
    • AVI-TEV (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site SnaB1, Sgf1 (not destroyed)
  • 5′ sequencing primer CGTTCGACCCCGCCTCGATCC
  • 3′ sequencing primer AGCTTGATATCGAATTCCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMIG-hNFATc2/C - AVITEV was a gift from Ria Baumgrass (Addgene plasmid # 74058 ; http://n2t.net/addgene:74058 ; RRID:Addgene_74058)
  • For your References section:

    Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333