Skip to main content
Addgene

AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1
(Plasmid #74150)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74150 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV synapsin intron
  • Backbone size w/o insert (bp) 4821
  • Total vector size (bp) 6579
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6s
  • Alt name
    GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
  • Species
    R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
  • Insert Size (bp)
    1353
  • Promoter Synapsin
  • Tag / Fusion Protein
    • H2B (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NruI (destroyed during cloning)
  • 3′ cloning site NruI (destroyed during cloning)
  • 5′ sequencing primer Intron f; gtatcaaggttacaagacag
  • 3′ sequencing primer AAV1621 r; gagttgtggcccgttgtcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector: AA0215 AAV Synapsin intron Pzac2.1 from Scott sternson lab hhmi/Jfrc.
Please note that the Addgene verified sequence was updated 2/25/22 due to an error in the original assembly. If you downloaded the sequence prior to this date, please note the transgene is in the opposite orientation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1 was a gift from Loren Looger (Addgene plasmid # 74150 ; http://n2t.net/addgene:74150 ; RRID:Addgene_74150)